Top » Catalog » SNPs » L1264

$18.00

L1264
[L1264]

L1264
hg38 Position: ChrY:7776327..7776327
Ancestral: A
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: G2a2b2a1a1a2a
Comments: Found in a hg G-U1 WTY participant
Forward Primer: L1264_F AAAATGTTAAAGTATTTCCAGACTTTGG
Reverse Primer: L1264_R GCATATCTTTAGGGCCATCCTC
Reviews

Customers who bought this product also purchased
Z6759
Z6759
Y107131
Y107131
U1
U1
Y32597
Y32597
Y169201
Y169201
G2a-L1259 Panel
G2a-L1259 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies