Top » Catalog » SNPs » L1264

$18.00

L1264
[L1264]

L1264
hg38 Position: ChrY:7776327..7776327
Ancestral: A
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: G2a2b2a1a1a2a
Comments: Found in a hg G-U1 WTY participant
Forward Primer: L1264_F AAAATGTTAAAGTATTTCCAGACTTTGG
Reverse Primer: L1264_R GCATATCTTTAGGGCCATCCTC
Reviews

Customers who bought this product also purchased
M172
M172
L140
L140
PH3992
PH3992
M96
M96
Z6552
Z6552
Z6764
Z6764
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies