Top » Catalog » SNPs » FGC14457

$18.00

FGC14457
[FGC14457]

FGC14457
hg38 Position: ChrY:15633940..15633940
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: I2a1b2 (not listed)
Comments: discriminating for L161 subclade C
Forward Primer: FGC14457_F TTGAGGGTATCAGTGCTGAGTG
Reverse Primer: FGC14457_R CACAATTATGCCCAGCTGC
Reviews

Customers who bought this product also purchased
FGC14463
FGC14463
FGC7174
FGC7174
CTS10228
CTS10228
L161.1
L161.1
A7729
A7729
A544
A544
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies