Top » Catalog » SNPs » FGC14457

$18.00

FGC14457
[FGC14457]

FGC14457
hg38 Position: ChrY:15633940..15633940
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: I2a1b2 (not listed)
Comments: discriminating for L161 subclade C
Forward Primer: FGC14457_F TTGAGGGTATCAGTGCTGAGTG
Reverse Primer: FGC14457_R CACAATTATGCCCAGCTGC
Reviews

Customers who bought this product also purchased
A5875
A5875
BY106777
BY106777
A5877
A5877
Y43331
Y43331
A2329
A2329
Y151633
Y151633
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies