Top » Catalog » SNPs » FGC22530

$18.00

FGC22530
[FGC22530]

FGC22530
hg38 Position: ChrY:13788370..13788370
Ancestral: T
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2b1 (not listed)
Comments: .
Forward Primer: FGC22530v2_F GCTTCCCATTACTGGATGGA
Reverse Primer: FGC22530v2_R ACAAATGGTAGGCACGTTTTAATC
Reviews

Customers who bought this product also purchased
FGC22549
FGC22549
FGC22503
FGC22503
FGC22541
FGC22541
FGC22538
FGC22538
FGC22529
FGC22529
R1b-FGC22503 Wheaton Panel
R1b-FGC22503 Wheaton Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies