Top » Catalog » SNPs » FGC22530

$18.00

FGC22530
[FGC22530]

FGC22530
hg38 Position: ChrY:13788370..13788370
Ancestral: T
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2b1 (not listed)
Comments: .
Forward Primer: FGC22530v2_F GCTTCCCATTACTGGATGGA
Reverse Primer: FGC22530v2_R ACAAATGGTAGGCACGTTTTAATC
Reviews

Customers who bought this product also purchased
FGC22512
FGC22512
FGC22549
FGC22549
FGC22503
FGC22503
FGC22541
FGC22541
FGC22538
FGC22538
FGC22529
FGC22529
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies