Top » Catalog » SNPs » Y19285

$18.00

Y19285
[Y19285]

Y19285
hg38 Position: ChrY:16712392..16712392
Ancestral: G
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: I2a1b1b
Comments: Downstream of L161
Forward Primer: Y19285_F GGAAATCAAATGTATGAAATATGCC
Reverse Primer: Y19285_R CCAAAAGGTCTGGGAGGAC
Reviews

Customers who bought this product also purchased
DYS513
DYS513
DYS570
DYS570
DYS458
DYS458
DNA Sample Kit
DNA Sample Kit
A9877
A9877
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies