Top » Catalog » SNPs » A1603

$18.00

A1603
[A1603]

A1603
hg38 Position: ChrY:8601264..8601264
Ancestral: G
Derived: A
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140 Z141+ [13] Branch
Forward Primer: A1603vl_F CCTGGATGGGACTGACTTTG
Reverse Primer: A1603vl_R GTGCCCAGCTGTCAGAGG
Reviews

Customers who bought this product also purchased
I1-Z140 Panel
I1-Z140 Panel
A1601
A1601
Z140
Z140
Y6231
Y6231
Z2539
Z2539
A196
A196
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x SK345
$18.00
Haplogroup Info
Other products
Currencies