Top » Catalog » SNPs » A1603

$18.00

A1603
[A1603]

A1603
hg38 Position: ChrY:8601264..8601264
Ancestral: G
Derived: A
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140 Z141+ [13] Branch
Forward Primer: A1603vl_F CCTGGATGGGACTGACTTTG
Reverse Primer: A1603vl_R GTGCCCAGCTGTCAGAGG
Reviews

Customers who bought this product also purchased
BY178134
BY178134
FGC65549
FGC65549
CTS6739
CTS6739
S1990
S1990
Y7397
Y7397
Z59
Z59
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies