Top » Catalog » SNPs » A1609

$18.00

A1609
[A1609]

A1609
hg38 Position: ChrY:12517880..12517880
Ancestral: C
Derived: G
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140 Z141+ [13] Branch
Forward Primer: A1609_F GGTCCAGGTAGCAATGAATCC
Reverse Primer: A1609_R ACAATATTTGGTGAAACCCACC
Reviews

Customers who bought this product also purchased
I1-A1605 Crawford Core Segregation Panel
I1-A1605 Crawford Core Segregation Panel
A1612
A1612
A1602
A1602
A1619
A1619
A1601
A1601
A1615
A1615
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies