Top » Catalog » SNPs » A1613

$18.00

A1613
[A1613]

A1613
hg38 Position: ChrY:16122358..16122358
Ancestral: T
Derived: C
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140 Z141+ [13] Branch
Forward Primer: A1613_F TGTTTCAAAACCTGGAAGTGG
Reverse Primer: A1613_R TCTGGGCAAGTCTGGAAGTC
Reviews

Customers who bought this product also purchased
A1615
A1615
A1596
A1596
A1614
A1614
A10700
A10700
A1612
A1612
I1-A1605 Crawford Core Segregation Panel
I1-A1605 Crawford Core Segregation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies