Top » Catalog » SNPs » A1619

$18.00

A1619
[A1619]

A1619
hg38 Position: ChrY:12099195..12099195
Ancestral: C
Derived: T
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140 Z141+ [13] Branch
Forward Primer: A1619_F GAGAAGGAGAAGGAGAAGATTACAAG
Reverse Primer: A1619_R GAAAGGCTCCTGGGTTCAAG
Reviews

Customers who bought this product also purchased
A1602
A1602
A1615
A1615
A1601
A1601
A1614
A1614
A1596
A1596
A1613
A1613
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies