Top » Catalog » SNPs » FGC7156

$18.00

FGC7156
[FGC7156]

FGC7156
hg38 Position: ChrY:2817292..2817292
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R2a3a2b2c1b1a
Comments: discriminating for L161 subclade Isles D
Forward Primer: FGC7156_F GGCATCCTTGTCTTTTTCTGATC
Reverse Primer: FGC7156_R GAGATGCAACAGCAGCAAAC
Reviews

Customers who bought this product also purchased
A5913
A5913
A20333
A20333
A19620
A19620
F3145
F3145
Y4882
Y4882
Y52621
Y52621
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies