Top » Catalog » SNPs » FGC7174

$18.00

FGC7174
[FGC7174]

FGC7174
hg38 Position: ChrY:8662084..8662084
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: I2a1b2 (not listed)
Comments: discriminating for L161 subclades Isles C and D
Forward Primer: FGC7174_F CGTGGTTCCTACCTTTACCATAAAG
Reverse Primer: FGC7174_R TGACACAGGTTTGAGCATCC
Reviews

Customers who bought this product also purchased
S7714
S7714
Y14338
Y14338
S2679
S2679
FGC14457
FGC14457
A7729
A7729
Y3734
Y3734
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies