Top » Catalog » SNPs » FGC7183

$18.00

FGC7183
[FGC7183]

FGC7183
hg38 Position: ChrY:12165552..12165552
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: I2a1b2 (not listed)
Comments: discriminating for L161 subclade Isles D
Forward Primer: FGC7183_F CCAGGTGTCGTGGTATGTG
Reverse Primer: FGC7183_R CCTTCTAACAATTCGACATCCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies