Top » Catalog » SNPs » FGC4357

$18.00

FGC4357
[FGC4357]

FGC4357
hg38 Position: ChrY:21672054..21672054
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: Below FGC6 > FGC4340
Forward Primer: FGC4357_F CTAGCAAATTTAAAAGCAATTACCG
Reverse Primer: FGC4357_R GCAGGGTATGGTTGTGCCT
Reviews

Customers who bought this product also purchased
FGC7942
FGC7942
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies