Top » Catalog » SNPs » FGC42643

$19.00

FGC42643
[FGC42643]

FGC42643
hg38 Position: ChrY:8899778..8899778
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream S659 > FGC4077 > A725
Forward Primer: FGC42643v2_F GGTAGCCTAGTGACTATAACCAGTGG
Reverse Primer: FGC42643v2_R TATTTCATAAATTCTTCAAGAACTCTGAC
Reviews

Customers who bought this product also purchased
A725
A725
FGC42641
FGC42641
FGC42645
FGC42645
FGC42653
FGC42653
FGC42640
FGC42640
FGC42651
FGC42651
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies