Top » Catalog » SNPs » FGC42643

$18.00

FGC42643
[FGC42643]

FGC42643
hg38 Position: ChrY:8899778..8899778
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream S659 > FGC4077 > A725
Forward Primer: FGC42643v2_F GGTAGCCTAGTGACTATAACCAGTGG
Reverse Primer: FGC42643v2_R TATTTCATAAATTCTTCAAGAACTCTGAC
Reviews

Customers who bought this product also purchased
A725
A725
FGC42653
FGC42653
FGC42640
FGC42640
FGC42651
FGC42651
FGC42652
FGC42652
R1b-A725 Ross Panel
R1b-A725 Ross Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies