Top » Catalog » SNPs » FGC42645

$18.00

FGC42645
[FGC42645]

FGC42645
hg38 Position: ChrY:12670958..12670958
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream S659 > FGC4077 > A725
Forward Primer: FGC42645_F TATCATGAAACTTTTGGGCAAC
Reverse Primer: FGC42645_R ACCTGACGCAAGGATGTTTC
Reviews

Customers who bought this product also purchased
A725
A725
R1b-A725 Ross Panel
R1b-A725 Ross Panel
FGC42648
FGC42648
FGC42650
FGC42650
FGC42646
FGC42646
FGC42649
FGC42649
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies