Top » Catalog » SNPs » FGC42647

$18.00

FGC42647
[FGC42647]

FGC42647
hg38 Position: ChrY:13337453..13337453
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC42647v2_F CAGGATATACAGCAGGACAGACC
Reverse Primer: FGC42647v2_R CTTCCCATCTTGGCAACTG
Reviews

Customers who bought this product also purchased
A725
A725
FGC42651
FGC42651
FGC42652
FGC42652
R1b-A725 Ross Panel
R1b-A725 Ross Panel
FGC42648
FGC42648
FGC42650
FGC42650
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies