Top » Catalog » SNPs » FGC42647

$18.00

FGC42647
[FGC42647]

FGC42647
hg38 Position: ChrY:13337453..13337453
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC42647v2_F CAGGATATACAGCAGGACAGACC
Reverse Primer: FGC42647v2_R CTTCCCATCTTGGCAACTG
Reviews

Customers who bought this product also purchased
A725
A725
FGC42650
FGC42650
FGC42646
FGC42646
FGC42649
FGC42649
FGC42642
FGC42642
FGC42645
FGC42645
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies