Top » Catalog » SNPs » FGC42650

$18.00

FGC42650
[FGC42650]

FGC42650
hg38 Position: ChrY:17050542..17050542
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC42650_F GGGCAGCTAGATAAATTACATGTCTC
Reverse Primer: FGC42650_R TCAAAGAGCTTCCCATAATATTTAGG
Reviews

Customers who bought this product also purchased
A725
A725
FGC42642
FGC42642
FGC42645
FGC42645
FGC42654
FGC42654
FGC42641
FGC42641
FGC42643
FGC42643
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies