Top » Catalog » SNPs » FGC42653

$18.00

FGC42653
[FGC42653]

FGC42653
hg38 Position: ChrY:17266634..17266634
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream S659 > FGC4077 > A725
Forward Primer: FGC42653_F TCATTATTCATCCTAAGTTCTGCTTC
Reverse Primer: FGC42653_R GCCAAGTTTCAACTATCACAAGC
Reviews

Customers who bought this product also purchased
A725
A725
FGC42649
FGC42649
FGC42646
FGC42646
FGC42647
FGC42647
FGC42642
FGC42642
FGC42645
FGC42645
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies