Top » Catalog » SNPs » FGC42653

$18.00

FGC42653
[FGC42653]

FGC42653
hg38 Position: ChrY:17266634..17266634
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream S659 > FGC4077 > A725
Forward Primer: FGC42653_F TCATTATTCATCCTAAGTTCTGCTTC
Reverse Primer: FGC42653_R GCCAAGTTTCAACTATCACAAGC
Reviews

Customers who bought this product also purchased
A725
A725
FGC42640
FGC42640
FGC42651
FGC42651
FGC42650
FGC42650
R1b-A725 Ross Panel
R1b-A725 Ross Panel
FGC42648
FGC42648
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies