Top » Catalog » SNPs » FGC42654

$18.00

FGC42654
[FGC42654]

FGC42654
hg38 Position: ChrY:17366039..17366039
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC42654_F CACTGTGCAGCAGAGATTGC
Reverse Primer: FGC42654_R AGCTACCGGGGAAGCTAAAG
Reviews

Customers who bought this product also purchased
A725
A725
R1b-A725 Ross Panel
R1b-A725 Ross Panel
FGC42648
FGC42648
FGC42649
FGC42649
FGC42646
FGC42646
FGC42647
FGC42647
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies