Top » Catalog » SNPs » FGC42654

$18.00

FGC42654
[FGC42654]

FGC42654
hg38 Position: ChrY:17366039..17366039
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC42654_F CACTGTGCAGCAGAGATTGC
Reverse Primer: FGC42654_R AGCTACCGGGGAAGCTAAAG
Reviews

Customers who bought this product also purchased
A725
A725
FGC42641
FGC42641
FGC42643
FGC42643
FGC42652
FGC42652
FGC42640
FGC42640
FGC42651
FGC42651
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies