Top » Catalog » SNPs » Y12073

$18.00

Y12073
[Y12073]

Y12073
hg38 Position: ChrY:15277296..15277296
Ancestral: G
Derived: T
Reference: Yfull (2015)
ISOGG Haplogroup: I2a (not listed)
Comments: Below A813 > Y12075
Forward Primer: Y12073_F GTCTTTAAGAGCTAGTGATTTCCAGG
Reverse Primer: Y12073_R ACTGTACAGTGATTCTAGCAGACATG
Reviews

Customers who bought this product also purchased
Wish a STR
Wish a STR
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies