Top » Catalog » SNPs » Y12073

$19.00

Y12073
[Y12073]

Y12073
hg38 Position: ChrY:15277296..15277296
Ancestral: G
Derived: T
Reference: Yfull (2015)
ISOGG Haplogroup: I2a (not listed)
Comments: Below A813 > Y12075
Forward Primer: Y12073_F GTCTTTAAGAGCTAGTGATTTCCAGG
Reverse Primer: Y12073_R ACTGTACAGTGATTCTAGCAGACATG
Reviews (1)

Customers who bought this product also purchased
Y5595
Y5595
A13909
A13909
A5874
A5874
A12505
A12505
Y12075
Y12075
Y32084
Y32084
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11429
$19.00
Haplogroup Info
Other products
Currencies