Top » Catalog » SNPs » Y12073

$19.00

Y12073
[Y12073]

Y12073
hg38 Position: ChrY:15277296..15277296
Ancestral: G
Derived: T
Reference: Yfull (2015)
ISOGG Haplogroup: I2a (not listed)
Comments: Below A813 > Y12075
Forward Primer: Y12073_F GTCTTTAAGAGCTAGTGATTTCCAGG
Reverse Primer: Y12073_R ACTGTACAGTGATTCTAGCAGACATG
Reviews (1)

Customers who bought this product also purchased
Y4460
Y4460
Y103938
Y103938
Y144305
Y144305
A20031
A20031
L1498
L1498
Y16473
Y16473
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A27251
$19.00
Haplogroup Info
Other products
Currencies