Top » Catalog » SNPs » Y12075

$18.00

Y12075
[Y12075]

Y12075
hg38 Position: ChrY:17182569..17182569
Ancestral: A
Derived: C
Reference: Yfull (2015)
ISOGG Haplogroup: I2a (not listed)
Comments: Below L161.1 > A813
Forward Primer: Y12075_F CCTCCTCTACCCTCCCTTTC
Reverse Primer: Y12075_R TGCAGTCAGAGTCTCCCCTAAC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
A11115
A11115
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies