Top » Catalog » SNPs » Y12075

$18.00

Y12075
[Y12075]

Y12075
hg38 Position: ChrY:17182569..17182569
Ancestral: A
Derived: C
Reference: Yfull (2015)
ISOGG Haplogroup: I2a (not listed)
Comments: Below L161.1 > A813
Forward Primer: Y12075_F CCTCCTCTACCCTCCCTTTC
Reverse Primer: Y12075_R TGCAGTCAGAGTCTCCCCTAAC
Reviews

Customers who bought this product also purchased
A11115
A11115
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies