Top » Catalog » SNPs » BY150

$18.00

BY150
[BY150]

BY150
hg38 Position: ChrY:7921386..7921386
Ancestral: C
Derived: A
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1k~
Comments: Below S764 > Z17612
Forward Primer: BY150v2_F GAGTAACAATTTCAAGCTTTGATGG
Reverse Primer: BY150v2_R TGGACTGGATCCTGCCTATG
Reviews

Customers who bought this product also purchased
DF41
DF41
Z17614
Z17614
BY154
BY154
L1335
L1335
A861
A861
A33
A33
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies