Top » Catalog » SNPs » Y17075

$18.00

Y17075
[Y17075]

Y17075
HG19 Position: ChrY:19476430..19476430
Ancestral: T
Derived: G
Reference: YFull (2015)
ISOGG Haplogroup: R1b
Comments: Below S744
Forward Primer: Y17075_F AAGAAAAGGTATCATGGAGATCATATG
Reverse Primer: Y17075_R CAGGTTGTCTAGTCTGGTCACC
Reviews

Customers who bought this product also purchased
A1141
A1141
S764
S764
S6198
S6198
S744
S744
F144
F144
R1b-L1335 Scots Panel
R1b-L1335 Scots Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies