Top » Catalog » SNPs » Y17075

$18.00

Y17075
[Y17075]

Y17075
hg38 Position: ChrY:17364550..17364550
Ancestral: T
Derived: G
Reference: YFull (2015)
ISOGG Haplogroup: R1b
Comments: Below S744
Forward Primer: Y17075_F AAGAAAAGGTATCATGGAGATCATATG
Reverse Primer: Y17075_R CAGGTTGTCTAGTCTGGTCACC
Reviews

Customers who bought this product also purchased
S744
S744
F144
F144
R1b-L1335 Scots Panel
R1b-L1335 Scots Panel
Y15478
Y15478
A9355
A9355
CTS4931
CTS4931
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies