Top » Catalog » SNPs » Y17075

$18.00

Y17075
[Y17075]

Y17075
HG19 Position: ChrY:17364550..17364550
Ancestral: T
Derived: G
Reference: YFull (2015)
ISOGG Haplogroup: R1b
Comments: Below S744
Forward Primer: Y17075_F AAGAAAAGGTATCATGGAGATCATATG
Reverse Primer: Y17075_R CAGGTTGTCTAGTCTGGTCACC
Reviews

Customers who bought this product also purchased
PF5236
PF5236
S691
S691
A1141
A1141
S764
S764
S6198
S6198
S744
S744
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies