Top » Catalog » SNPs » BY3137

$18.00

BY3137
[BY3137]

BY3137
hg38 Position: ChrY:13450423..13450423
Ancestral: A
Derived: C
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S764 > Z17611 > BY150
Forward Primer: BY3137_F GTGAAAATCTATCGTATTGTAGCCTG
Reverse Primer: BY3137_R GATTCTCCTGCCTCAGCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies