Top » Catalog » SNPs » FGC19785

$18.00

FGC19785
[FGC19785]

FGC19785
hg38 Position: ChrY:15993933..15993933
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S764 > Z17612 > FGC17603
Forward Primer: FGC19785_F GCACATTATAATGGGAGATCTCTG
Reverse Primer: FGC19785_R CATTCCTACATTCTGATTTCCAAGTAC
Reviews

Customers who bought this product also purchased
S691
S691
BY150
BY150
S764
S764
FGC17603
FGC17603
S744
S744
Y16252
Y16252
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies