Top » Catalog » SNPs » FGC19785

$18.00

FGC19785
[FGC19785]

FGC19785
HG19 Position: ChrY:15993933..15993933
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S764 > Z17612 > FGC17603
Forward Primer: FGC19785_F GCACATTATAATGGGAGATCTCTG
Reverse Primer: FGC19785_R CATTCCTACATTCTGATTTCCAAGTAC
Reviews

Customers who bought this product also purchased
R1b-L1335 Scots Panel
R1b-L1335 Scots Panel
S756
S756
Z17613
Z17613
S691
S691
BY150
BY150
S764
S764
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies