Top » Catalog » SNPs » L20

$18.00

L20
[L20]

L20
hg38 Position: ChrY:12110586..12110586
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2b1a1
Comments: aka rs7067305
Forward Primer: L20_F AGTTCTGCACATTGTCATTTGC
Reverse Primer: L20_R GTTTCTGAGGTTATTTTTATTGCATC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x YSEQ-Gamma
1 x YSEQ-Beta
1 x mtComplete
1 x HVR2
1 x HVR1
1 x mtUpgrade
$483.00
Haplogroup Info
Other products
Currencies