Top » Catalog » SNPs » L20

$18.00

L20
[L20]

L20
hg38 Position: ChrY:12110586..12110586
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2b1a1
Comments: aka rs7067305
Forward Primer: L20_F AGTTCTGCACATTGTCATTTGC
Reverse Primer: L20_R GTTTCTGAGGTTATTTTTATTGCATC
Reviews

Customers who bought this product also purchased
S1051
S1051
DF27
DF27
A1101
A1101
Z39589
Z39589
Z251
Z251
P312
P312
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies