Top » Catalog » SNPs » L20

$18.00

L20
[L20]

L20
hg38 Position: ChrY:12110586..12110586
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2b1a1
Comments: aka rs7067305
Forward Primer: L20_F AGTTCTGCACATTGTCATTTGC
Reverse Primer: L20_R GTTTCTGAGGTTATTTTTATTGCATC
Reviews

Customers who bought this product also purchased
FT20578
FT20578
BY69713
BY69713
Z33
Z33
BY149308
BY149308
Wish a SNP
Wish a SNP
BY133159
BY133159
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies