Top » Catalog » SNPs » L20

$18.00

L20
[L20]

L20
hg38 Position: ChrY:12110586..12110586
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2b1a1
Comments: aka rs7067305
Forward Primer: L20_F AGTTCTGCACATTGTCATTTGC
Reverse Primer: L20_R GTTTCTGAGGTTATTTTTATTGCATC
Reviews

Customers who bought this product also purchased
DF49
DF49
S1026
S1026
DF19
DF19
A1105
A1105
DF13
DF13
S1051
S1051
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC30566
$18.00
Haplogroup Info
Other products
Currencies