Top » Catalog » SNPs » Y19740

$18.00

Y19740
[Y19740]

Y19740
hg38 Position: ChrY:13839494..13839494
Ancestral: T
Derived: C
Reference: Yfull (2015)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y19740v2_F GTCTATTTTGTTCTTGATTCATCTGG
Reverse Primer: Y19740v2_R TTATATTACGTATGAAGTCATTCAAGACC
Reviews

Customers who bought this product also purchased
Y17446
Y17446
FGC20759
FGC20759
FGC20764
FGC20764
FGC20767
FGC20767
A10503
A10503
Z196
Z196
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies