Top » Catalog » SNPs » PLE07

$18.00

PLE07
[PLE07]

PLE07
hg38 Position: ChrY:16476731..16476731
Ancestral: C
Derived: G
Reference: Stanislaw J. Plewako (2016)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: PLE07_F CTTTGGGAGGCTGAGTTGTG
Reverse Primer: PLE07_R GTGTCCTGCCCACCTTTG
Reviews

Customers who bought this product also purchased
Y152112
Y152112
Z17855
Z17855
A13909
A13909
A5874
A5874
Y3118
Y3118
A2329
A2329
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies