Top » Catalog » SNPs » BY3863

$18.00

BY3863
[BY3863]

BY3863
hg38 Position: ChrY:20464503..20464503
Ancestral: G
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC11134 > S1121 > Z16521
Forward Primer: BY3863_F TGTACTTGCCTGTTGGTTGG
Reverse Primer: BY3863_R TTTCCCATCTATGTCCTGGTG
Reviews

Customers who bought this product also purchased
BY39364
BY39364
Z16521
Z16521
FGC29280
FGC29280
A159
A159
FGC42469
FGC42469
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies