Top » Catalog » SNPs » MZ22

$18.00

MZ22
[MZ22]

MZ22
hg38 Position: ChrY:8373618..8373618
Ancestral: A
Derived: C
Reference: E-M81 community (2015)
ISOGG Haplogroup: E1b1b1b1a
Comments: Downstream M81 > PF6789
Forward Primer: MZ22_F GGCTTCAGGGATGAGAGTACTG
Reverse Primer: MZ22_R GGAGATATTTTGACTCTCACCATTG
Reviews

Customers who bought this product also purchased
BY10126
BY10126
FT234139
FT234139
Y183077
Y183077
L335
L335
MZ5
MZ5
M5043
M5043
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies