Top » Catalog » SNPs » MZ22

$18.00

MZ22
[MZ22]

MZ22
hg38 Position: ChrY:8373618..8373618
Ancestral: A
Derived: C
Reference: E-M81 community (2015)
ISOGG Haplogroup: E1b1b1b1a
Comments: Downstream M81 > PF6789
Forward Primer: MZ22_F GGCTTCAGGGATGAGAGTACTG
Reverse Primer: MZ22_R GGAGATATTTTGACTCTCACCATTG
Reviews

Customers who bought this product also purchased
Y141584
Y141584
Y190325
Y190325
MZ247
MZ247
BY10132
BY10132
MZ117
MZ117
Y22558
Y22558
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies