Top » Catalog » SNPs » FGC42837

$18.00

FGC42837
[FGC42837]

FGC42837
hg38 Position: ChrY:19757807..19757807
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC42837_F CTTGGCCTCCCAGAGTGT
Reverse Primer: FGC42837_R GAAAATTGAATTGAACCCCTTG
Reviews

Customers who bought this product also purchased
FGC52345
FGC52345
FGC5
FGC5
ZS5801
ZS5801
A12921
A12921
FGC1707
FGC1707
ZS5809
ZS5809
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies