Top » Catalog » SNPs » FGC42837

$18.00

FGC42837
[FGC42837]

FGC42837
hg38 Position: ChrY:19757807..19757807
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC42837_F CTTGGCCTCCCAGAGTGT
Reverse Primer: FGC42837_R GAAAATTGAATTGAACCCCTTG
Reviews

Customers who bought this product also purchased
ZS5804
ZS5804
A18554
A18554
A18553
A18553
YFS1350909
YFS1350909
ZS8569
ZS8569
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PH2651
$18.00
Haplogroup Info
Other products
Currencies