Top » Catalog » SNPs » MZ5

$18.00

MZ5
[MZ5]

MZ5
hg38 Position: ChrY:21390193..21390193
Ancestral: C
Derived: T
Reference: E-M81 community (2015)
ISOGG Haplogroup: E1b1b1b1a
Comments: Downstream PF6789 PF6799 MZ1
Forward Primer: MZ5_F GGAATTTTGCAGAGAAAATCACT
Reverse Primer: MZ5_R AAGCCAGCATAGTGTTGCG
Reviews

Customers who bought this product also purchased
M96
M96
M5043
M5043
BY10132
BY10132
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
Z5009
Z5009
PF6789
PF6789
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies