Top » Catalog » SNPs » BY3716

$18.00

BY3716
[BY3716]

BY3716
hg38 Position: ChrY:9549356..9549356
Ancestral: G
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: BY3716_F TCATTCCTGTAAGCAACAGCA
Reverse Primer: BY3716_R ACCAGTTGAAGAATTCAGGCTC
Reviews

Customers who bought this product also purchased
Z2103
Z2103
CTS9219
CTS9219
Y30217
Y30217
Z2106
Z2106
A13597
A13597
FGC14589
FGC14589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies