Top » Catalog » SNPs » BY3716

$18.00

BY3716
[BY3716]

BY3716
hg38 Position: ChrY:9549356..9549356
Ancestral: G
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: BY3716_F TCATTCCTGTAAGCAACAGCA
Reverse Primer: BY3716_R ACCAGTTGAAGAATTCAGGCTC
Reviews

Customers who bought this product also purchased
FGC14589
FGC14589
M12135
M12135
R1b-Z2103 Panel
R1b-Z2103 Panel
A366
A366
Z2103
Z2103
CTS9219
CTS9219
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies