Top » Catalog » SNPs » FGC13333

$18.00

FGC13333
[FGC13333]

FGC13333
hg38 Position: ChrY:8282879..8282879
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > DF98
Forward Primer: FGC13333_F CCATCATTTTCTGTAACAATGACAG
Reverse Primer: FGC13333_R GCCTCACATAAGAATTGCAATCA
Reviews

Customers who bought this product also purchased
FGC51008
FGC51008
Z301
Z301
DF96
DF96
L48
L48
U106
U106
FGC51006
FGC51006
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies