Top » Catalog » SNPs » FGC13333

$18.00

FGC13333
[FGC13333]

FGC13333
hg38 Position: ChrY:8282879..8282879
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > DF98
Forward Primer: FGC13333_F CCATCATTTTCTGTAACAATGACAG
Reverse Primer: FGC13333_R GCCTCACATAAGAATTGCAATCA
Reviews

Customers who bought this product also purchased
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
S18823
S18823
Z4303
Z4303
CTS7550
CTS7550
Z381
Z381
DF98
DF98
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies