Top » Catalog » SNPs » PF374

$18.00

PF374
[PF374]

PF374
hg38 Position: ChrY:10106023..10106023
Ancestral: A
Derived: C
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. with FGC22149
Forward Primer: PF374_F CCAGTAGTGACTACATGGTGCC
Reverse Primer: PF374_R GTCCTCCAGTCACTGTGCC
Reviews

Customers who bought this product also purchased
A10165
A10165
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies