Top » Catalog » SNPs » Y12419

$18.00

Y12419
[Y12419]

Y12419
hg38 Position: ChrY:12069164..12069164
Ancestral: T
Derived: A
Reference: Yfull (2015)
ISOGG Haplogroup: L1a2a1b~
Comments: Below M22 > L1307 > Z5920
Forward Primer: Y12419_F AAACATGAGCAATAACACTCAAGG
Reverse Primer: Y12419_R CCATGCAGACTTCTCTTCTGTATTG
Reviews

Customers who bought this product also purchased
Y76629
Y76629
Y12889
Y12889
Z5920
Z5920
FGC40735
FGC40735
L-M20 Panel
L-M20 Panel
M2667
M2667
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies